Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method

Y. Hayakawa, R. Kawai, A. Hirata, J. I. Sugimoto, M. Kataoka, Akira Sakakura, M. Hirose, R. Noyori

Research output: Contribution to journalArticle

65 Citations (Scopus)

Abstract

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3′-(allyl N,N-diisopropylphosphoramidite)s or 3′-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3′-O-(tert-butyldimethylsilyl)ribonucleoside 2′-(N,N-diisopropylphosphoramidite)s or 2′-O-(tert-butyldimethylsilyl)-ribonucleoside 3′-(N,N-diisopropylphosphoramidite)s used for the formation of 2′-5′ and 3′-5′ internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5′-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, 5′CGACACCCAATTCTGAAAAT3′ (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3′-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3′-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as 5′AGCUACGUGACUACUACUUU3′ (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5′-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2′-5′)adenylyl(2′-5′)adenosine (2-5A core).

Original languageEnglish
Pages (from-to)8165-8176
Number of pages12
JournalJournal of the American Chemical Society
Volume123
Issue number34
DOIs
Publication statusPublished - 2001
Externally publishedYes

Fingerprint

Azoles
Ribonucleosides
RNA
Nucleosides
Oligomers
DNA
Salts
Oligoribonucleotides
Deoxyribonucleotides
Deoxyribonucleosides
Solid-Phase Synthesis Techniques
Acids
Oligodeoxyribonucleotides
Condensation
Cytidine
Polystyrenes
Molecular sieves
Liquids
N-Acetylneuraminic Acid
Acetonitrile

ASJC Scopus subject areas

  • Chemistry(all)

Cite this

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method. / Hayakawa, Y.; Kawai, R.; Hirata, A.; Sugimoto, J. I.; Kataoka, M.; Sakakura, Akira; Hirose, M.; Noyori, R.

In: Journal of the American Chemical Society, Vol. 123, No. 34, 2001, p. 8165-8176.

Research output: Contribution to journalArticle

Hayakawa, Y. ; Kawai, R. ; Hirata, A. ; Sugimoto, J. I. ; Kataoka, M. ; Sakakura, Akira ; Hirose, M. ; Noyori, R. / Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method. In: Journal of the American Chemical Society. 2001 ; Vol. 123, No. 34. pp. 8165-8176.
@article{53a787d4bd204f6588780bbfb3ce3bd5,
title = "Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method",
abstract = "The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3′-(allyl N,N-diisopropylphosphoramidite)s or 3′-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3′-O-(tert-butyldimethylsilyl)ribonucleoside 2′-(N,N-diisopropylphosphoramidite)s or 2′-O-(tert-butyldimethylsilyl)-ribonucleoside 3′-(N,N-diisopropylphosphoramidite)s used for the formation of 2′-5′ and 3′-5′ internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5′-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, 5′CGACACCCAATTCTGAAAAT3′ (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3′-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3′-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as 5′AGCUACGUGACUACUACUUU3′ (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5′-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2′-5′)adenylyl(2′-5′)adenosine (2-5A core).",
author = "Y. Hayakawa and R. Kawai and A. Hirata and Sugimoto, {J. I.} and M. Kataoka and Akira Sakakura and M. Hirose and R. Noyori",
year = "2001",
doi = "10.1021/ja010078v",
language = "English",
volume = "123",
pages = "8165--8176",
journal = "Journal of the American Chemical Society",
issn = "0002-7863",
publisher = "American Chemical Society",
number = "34",

}

TY - JOUR

T1 - Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method

AU - Hayakawa, Y.

AU - Kawai, R.

AU - Hirata, A.

AU - Sugimoto, J. I.

AU - Kataoka, M.

AU - Sakakura, Akira

AU - Hirose, M.

AU - Noyori, R.

PY - 2001

Y1 - 2001

N2 - The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3′-(allyl N,N-diisopropylphosphoramidite)s or 3′-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3′-O-(tert-butyldimethylsilyl)ribonucleoside 2′-(N,N-diisopropylphosphoramidite)s or 2′-O-(tert-butyldimethylsilyl)-ribonucleoside 3′-(N,N-diisopropylphosphoramidite)s used for the formation of 2′-5′ and 3′-5′ internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5′-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, 5′CGACACCCAATTCTGAAAAT3′ (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3′-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3′-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as 5′AGCUACGUGACUACUACUUU3′ (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5′-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2′-5′)adenylyl(2′-5′)adenosine (2-5A core).

AB - The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3′-(allyl N,N-diisopropylphosphoramidite)s or 3′-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3′-O-(tert-butyldimethylsilyl)ribonucleoside 2′-(N,N-diisopropylphosphoramidite)s or 2′-O-(tert-butyldimethylsilyl)-ribonucleoside 3′-(N,N-diisopropylphosphoramidite)s used for the formation of 2′-5′ and 3′-5′ internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5′-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, 5′CGACACCCAATTCTGAAAAT3′ (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3′-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3′-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as 5′AGCUACGUGACUACUACUUU3′ (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5′-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2′-5′)adenylyl(2′-5′)adenosine (2-5A core).

UR - http://www.scopus.com/inward/record.url?scp=0034815285&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=0034815285&partnerID=8YFLogxK

U2 - 10.1021/ja010078v

DO - 10.1021/ja010078v

M3 - Article

C2 - 11516266

AN - SCOPUS:0034815285

VL - 123

SP - 8165

EP - 8176

JO - Journal of the American Chemical Society

JF - Journal of the American Chemical Society

SN - 0002-7863

IS - 34

ER -